The c.1082_1094del13 pathogenic mutation, located in coding exon 10 of the PMS2 gene, results from a deletion of 13 nucleotides at nucleotide positions 1082 to 1094, causing a translational frameshift with a predicted alternate stop codon (p.G361Vfs*6). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
ClinVar Genomic variation as it relates to human health
NM_000535.7(PMS2):c.1082_1094del (p.Gly361fs)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(1)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
1
criteria provided, single submitter
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000535.7(PMS2):c.1082_1094del (p.Gly361fs)
Variation ID: 1786664 Accession: VCV001786664.2
- Type and length
-
Deletion, 13 bp
- Location
-
Cytogenetic: 7p22.1 7: 5989850-5989862 (GRCh38) [ NCBI UCSC ] 7: 6029481-6029493 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 29, 2022 May 1, 2024 Sep 20, 2022 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000535.7:c.1082_1094del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000526.2:p.Gly361fs frameshift NM_000535.5:c.1082_1094del13 frameshift NM_001018040.1:c.669_681delTTTGATAGGAATG NP_001018050.1:p.Gly226Valfs frameshift NM_001322003.2:c.677_689del NP_001308932.1:p.Gly226fs frameshift NM_001322004.2:c.677_689del NP_001308933.1:p.Gly226fs frameshift NM_001322005.2:c.677_689del NP_001308934.1:p.Gly226fs frameshift NM_001322006.2:c.988+2111_988+2123del intron variant NM_001322007.2:c.764_776del NP_001308936.1:p.Gly255fs frameshift NM_001322008.2:c.764_776del NP_001308937.1:p.Gly255fs frameshift NM_001322009.2:c.677_689del NP_001308938.1:p.Gly226fs frameshift NM_001322010.2:c.583+2111_583+2123del intron variant NM_001322011.2:c.149_161del NP_001308940.1:p.Gly50fs frameshift NM_001322012.2:c.149_161del NP_001308941.1:p.Gly50fs frameshift NM_001322013.2:c.509_521del NP_001308942.1:p.Gly170fs frameshift NM_001322014.2:c.1082_1094del NP_001308943.1:p.Gly361fs frameshift NM_001322015.2:c.773_785del NP_001308944.1:p.Gly258fs frameshift NM_001406866.1:c.1260_1272delTTTGATAGGAATG NP_001393795.1:p.Gly423Valfs frameshift NM_001406868.1:c.1098_1110delTTTGATAGGAATG NP_001393797.1:p.Gly369Valfs frameshift NM_001406869.1:c.966_978delTTTGATAGGAATG NP_001393798.1:p.Gly325Valfs frameshift NM_001406871.1:c.1074_1086delTTTGATAGGAATG NP_001393800.1:p.Gly361Valfs frameshift NM_001406872.1:c.1074_1086delTTTGATAGGAATG NP_001393801.1:p.Gly361Valfs frameshift NM_001406873.1:c.876_888delTTTGATAGGAATG NP_001393802.1:p.Gly295Valfs frameshift NM_001406874.1:c.906_918delTTTGATAGGAATG NP_001393803.1:p.Gly305Valfs frameshift NM_001406875.1:c.765_777delTTTGATAGGAATG NP_001393804.1:p.Gly258Valfs frameshift NM_001406876.1:c.756_768delTTTGATAGGAATG NP_001393805.1:p.Gly255Valfs frameshift NM_001406877.1:c.765_777delTTTGATAGGAATG NP_001393806.1:p.Gly258Valfs frameshift NM_001406878.1:c.765_777delTTTGATAGGAATG NP_001393807.1:p.Gly258Valfs frameshift NM_001406879.1:c.765_777delTTTGATAGGAATG NP_001393808.1:p.Gly258Valfs frameshift NM_001406880.1:c.765_777delTTTGATAGGAATG NP_001393809.1:p.Gly258Valfs frameshift NM_001406881.1:c.765_777delTTTGATAGGAATG NP_001393810.1:p.Gly258Valfs frameshift NM_001406882.1:c.765_777delTTTGATAGGAATG NP_001393811.1:p.Gly258Valfs frameshift NM_001406883.1:c.756_768delTTTGATAGGAATG NP_001393812.1:p.Gly255Valfs frameshift NM_001406885.1:c.738_750delTTTGATAGGAATG NP_001393814.1:p.Gly249Valfs frameshift NM_001406886.1:c.708_720delTTTGATAGGAATG NP_001393815.1:p.Gly239Valfs frameshift NM_001406887.1:c.669_681delTTTGATAGGAATG NP_001393816.1:p.Gly226Valfs frameshift NM_001406888.1:c.669_681delTTTGATAGGAATG NP_001393817.1:p.Gly226Valfs frameshift NM_001406889.1:c.669_681delTTTGATAGGAATG NP_001393818.1:p.Gly226Valfs frameshift NM_001406890.1:c.669_681delTTTGATAGGAATG NP_001393819.1:p.Gly226Valfs frameshift NM_001406891.1:c.669_681delTTTGATAGGAATG NP_001393820.1:p.Gly226Valfs frameshift NM_001406892.1:c.669_681delTTTGATAGGAATG NP_001393821.1:p.Gly226Valfs frameshift NM_001406893.1:c.669_681delTTTGATAGGAATG NP_001393822.1:p.Gly226Valfs frameshift NM_001406894.1:c.669_681delTTTGATAGGAATG NP_001393823.1:p.Gly226Valfs frameshift NM_001406895.1:c.669_681delTTTGATAGGAATG NP_001393824.1:p.Gly226Valfs frameshift NM_001406896.1:c.669_681delTTTGATAGGAATG NP_001393825.1:p.Gly226Valfs frameshift NM_001406897.1:c.669_681delTTTGATAGGAATG NP_001393826.1:p.Gly226Valfs frameshift NM_001406898.1:c.669_681delTTTGATAGGAATG NP_001393827.1:p.Gly226Valfs frameshift NM_001406899.1:c.669_681delTTTGATAGGAATG NP_001393828.1:p.Gly226Valfs frameshift NM_001406903.1:c.756_768delTTTGATAGGAATG NP_001393832.1:p.Gly255Valfs frameshift NM_001406904.1:c.561_573delTTTGATAGGAATG NP_001393833.1:p.Gly190Valfs frameshift NM_001406905.1:c.561_573delTTTGATAGGAATG NP_001393834.1:p.Gly190Valfs frameshift NM_001406908.1:c.669_681delTTTGATAGGAATG NP_001393837.1:p.Gly226Valfs frameshift NM_001406909.1:c.501_513delTTTGATAGGAATG NP_001393838.1:p.Gly170Valfs frameshift NM_001406910.1:c.669_681delTTTGATAGGAATG NP_001393839.1:p.Gly226Valfs frameshift NM_001406911.1:c.303_315delTTTGATAGGAATG NP_001393840.1:p.Gly104Valfs frameshift NR_003085.2:n.1156_1168delTTTGATAGGAATG NR_136154.1:n.1169_1181del non-coding transcript variant NC_000007.14:g.5989858_5989870del NC_000007.13:g.6029489_6029501del NG_008466.1:g.24245_24257del LRG_161:g.24245_24257del LRG_161t1:c.1074_1086del LRG_161p1:p.Gly361Valfs - Protein change
- G50fs, G226fs, G255fs, G258fs, G361fs, G170fs
- Other names
- -
- Canonical SPDI
- NC_000007.14:5989849:CTATCAAACATTCCTATCAAA:CTATCAAA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| PMS2 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
5241 | 5343 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (1) |
criteria provided, single submitter
|
Sep 20, 2022 | RCV002430629.2 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Sep 20, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002731190.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.1082_1094del13 pathogenic mutation, located in coding exon 10 of the PMS2 gene, results from a deletion of 13 nucleotides at nucleotide positions 1082 to … (more)
The c.1082_1094del13 pathogenic mutation, located in coding exon 10 of the PMS2 gene, results from a deletion of 13 nucleotides at nucleotide positions 1082 to 1094, causing a translational frameshift with a predicted alternate stop codon (p.G361Vfs*6). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. (less)
|
Comment:
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
The c.1082_1094del13 pathogenic mutation, located in coding exon 10 of the PMS2 gene, results from a deletion of 13 nucleotides at nucleotide positions 1082 to 1094, causing a translational frameshift with a predicted alternate stop codon (p.G361Vfs*6). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated May 01, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.