ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.2065_2073dup (p.Leu691_Lys692insPheTyrLeu)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.2065_2073dup (p.Leu691_Lys692insPheTyrLeu)
Variation ID: 1785279 Accession: VCV001785279.2
- Type and length
-
Duplication, 9 bp
- Location
-
Cytogenetic: 2p16.3 2: 47800045-47800046 (GRCh38) [ NCBI UCSC ] 2: 48027184-48027185 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 29, 2022 May 1, 2024 May 21, 2018 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000179.3:c.2065_2073dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Leu691_Lys692insPheTyrLeu inframe insertion NM_000179.2:c.2065_2073dupTTCTACCTC inframe indel NM_001281492.2:c.1675_1683dup NP_001268421.1:p.Leu561_Lys562insPheTyrLeu inframe insertion NM_001281493.2:c.1159_1167dup NP_001268422.1:p.Leu389_Lys390insPheTyrLeu inframe insertion NM_001281494.2:c.1159_1167dup NP_001268423.1:p.Leu389_Lys390insPheTyrLeu inframe insertion NM_001406795.1:c.2161_2169dup NP_001393724.1:p.Leu723_Lys724insPheTyrLeu inframe indel NM_001406796.1:c.2065_2073dup NP_001393725.1:p.Leu691_Lys692insPheTyrLeu inframe indel NM_001406797.1:c.1768_1776dup NP_001393726.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406798.1:c.2065_2073dup NP_001393727.1:p.Leu691_Lys692insPheTyrLeu inframe indel NM_001406799.1:c.1540_1548dup NP_001393728.1:p.Leu516_Lys517insPheTyrLeu inframe indel NM_001406800.1:c.2065_2073dup NP_001393729.1:p.Leu691_Lys692insPheTyrLeu inframe indel NM_001406801.1:c.1768_1776dup NP_001393730.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406802.1:c.2161_2169dup NP_001393731.1:p.Leu723_Lys724insPheTyrLeu inframe indel NM_001406803.1:c.2065_2073dup NP_001393732.1:p.Leu691_Lys692insPheTyrLeu inframe indel NM_001406804.1:c.1987_1995dup NP_001393733.1:p.Leu665_Lys666insPheTyrLeu inframe indel NM_001406805.1:c.1768_1776dup NP_001393734.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406806.1:c.1540_1548dup NP_001393735.1:p.Leu516_Lys517insPheTyrLeu inframe indel NM_001406807.1:c.1540_1548dup NP_001393736.1:p.Leu516_Lys517insPheTyrLeu inframe indel NM_001406808.1:c.2065_2073dup NP_001393737.1:p.Leu691_Lys692insPheTyrLeu inframe indel NM_001406809.1:c.2065_2073dup NP_001393738.1:p.Leu691_Lys692insPheTyrLeu inframe indel NM_001406811.1:c.1159_1167dup NP_001393740.1:p.Leu389_Lys390insPheTyrLeu inframe indel NM_001406812.1:c.1159_1167dup NP_001393741.1:p.Leu389_Lys390insPheTyrLeu inframe indel NM_001406813.1:c.2071_2079dup NP_001393742.1:p.Leu693_Lys694insPheTyrLeu inframe indel NM_001406814.1:c.1159_1167dup NP_001393743.1:p.Leu389_Lys390insPheTyrLeu inframe indel NM_001406815.1:c.1159_1167dup NP_001393744.1:p.Leu389_Lys390insPheTyrLeu inframe indel NM_001406816.1:c.1159_1167dup NP_001393745.1:p.Leu389_Lys390insPheTyrLeu inframe indel NM_001406818.1:c.1768_1776dup NP_001393747.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406819.1:c.1768_1776dup NP_001393748.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406820.1:c.1768_1776dup NP_001393749.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406821.1:c.1768_1776dup NP_001393750.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406822.1:c.1768_1776dup NP_001393751.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406823.1:c.1159_1167dup NP_001393752.1:p.Leu389_Lys390insPheTyrLeu inframe indel NM_001406824.1:c.1768_1776dup NP_001393753.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406825.1:c.1768_1776dup NP_001393754.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406826.1:c.1897_1905dup NP_001393755.1:p.Leu635_Lys636insPheTyrLeu inframe indel NM_001406827.1:c.1768_1776dup NP_001393756.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406828.1:c.1768_1776dup NP_001393757.1:p.Leu592_Lys593insPheTyrLeu inframe indel NM_001406829.1:c.1159_1167dup NP_001393758.1:p.Leu389_Lys390insPheTyrLeu inframe indel NM_001406830.1:c.1768_1776dup NP_001393759.1:p.Leu592_Lys593insPheTyrLeu inframe indel NR_176256.1:n.927_935dup NR_176257.1:n.2154_2162dup NR_176258.1:n.2154_2162dup NR_176259.1:n.2154_2162dup NR_176261.1:n.2154_2162dup NC_000002.12:g.47800048_47800056dup NC_000002.11:g.48027187_48027195dup NG_007111.1:g.21902_21910dup LRG_219:g.21902_21910dup LRG_219t1:c.2065_2073dup LRG_219p1:p.Leu691_Lys692insPheTyrLeu - Protein change
- Other names
- -
- Canonical SPDI
- NC_000002.12:47800045:TCTTCTACCTC:TCTTCTACCTCTTCTACCTC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9148 | 9458 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Uncertain significance (1) |
criteria provided, single submitter
|
May 21, 2018 | RCV002422028.2 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(May 21, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002725153.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.2065_2073dupTTCTACCTC variant (also known as p.F689_L691dup) is located in coding exon 4 of the MSH6 gene. This variant results from an in-frame duplication of … (more)
The c.2065_2073dupTTCTACCTC variant (also known as p.F689_L691dup) is located in coding exon 4 of the MSH6 gene. This variant results from an in-frame duplication of 9 nucleotides at positions 2065 to 2073. This results in the insertion of 3 amino acids between codons 689 and 691. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated May 01, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.