The c.847_862del16 pathogenic mutation, located in coding exon 4 of the MSH6 gene, results from a deletion of 16 nucleotides at nucleotide positions 847 to 862, causing a translational frameshift with a predicted alternate stop codon (p.G283Kfs*3). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.847_862del (p.Gly283fs)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(2)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
2
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.847_862del (p.Gly283fs)
Variation ID: 1763510 Accession: VCV001763510.3
- Type and length
-
Deletion, 16 bp
- Location
-
Cytogenetic: 2p16.3 2: 47798825-47798840 (GRCh38) [ NCBI UCSC ] 2: 48025964-48025979 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 29, 2022 May 1, 2024 Mar 1, 2023 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000179.3:c.847_862del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Gly283fs frameshift NM_001281492.2:c.457_472del NP_001268421.1:p.Gly153fs frameshift NM_001281493.2:c.-60_-45del 5 prime UTR NM_001281494.2:c.-60_-45del 5 prime UTR NM_001406795.1:c.943_958del16 NP_001393724.1:p.Gly315Lysfs frameshift NM_001406796.1:c.847_862del16 NP_001393725.1:p.Gly283Lysfs frameshift NM_001406797.1:c.550_565del16 NP_001393726.1:p.Gly184Lysfs frameshift NM_001406798.1:c.847_862del16 NP_001393727.1:p.Gly283Lysfs frameshift NM_001406799.1:c.322_337del16 NP_001393728.1:p.Gly108Lysfs frameshift NM_001406800.1:c.847_862del16 NP_001393729.1:p.Gly283Lysfs frameshift NM_001406801.1:c.550_565del16 NP_001393730.1:p.Gly184Lysfs frameshift NM_001406802.1:c.943_958del16 NP_001393731.1:p.Gly315Lysfs frameshift NM_001406803.1:c.847_862del16 NP_001393732.1:p.Gly283Lysfs frameshift NM_001406804.1:c.769_784del16 NP_001393733.1:p.Gly257Lysfs frameshift NM_001406805.1:c.550_565del16 NP_001393734.1:p.Gly184Lysfs frameshift NM_001406806.1:c.322_337del16 NP_001393735.1:p.Gly108Lysfs frameshift NM_001406807.1:c.322_337del16 NP_001393736.1:p.Gly108Lysfs frameshift NM_001406808.1:c.847_862del16 NP_001393737.1:p.Gly283Lysfs frameshift NM_001406809.1:c.847_862del16 NP_001393738.1:p.Gly283Lysfs frameshift NM_001406811.1:c.-60_-45del16 NM_001406812.1:c.-60_-45del16 NM_001406813.1:c.853_868del16 NP_001393742.1:p.Gly285Lysfs frameshift NM_001406814.1:c.-60_-45del16 NM_001406815.1:c.-60_-45del16 NM_001406816.1:c.-60_-45del16 NM_001406817.1:c.847_862del16 NP_001393746.1:p.Gly283Lysfs frameshift NM_001406818.1:c.550_565del16 NP_001393747.1:p.Gly184Lysfs frameshift NM_001406819.1:c.550_565del16 NP_001393748.1:p.Gly184Lysfs frameshift NM_001406820.1:c.550_565del16 NP_001393749.1:p.Gly184Lysfs frameshift NM_001406821.1:c.550_565del16 NP_001393750.1:p.Gly184Lysfs frameshift NM_001406822.1:c.550_565del16 NP_001393751.1:p.Gly184Lysfs frameshift NM_001406823.1:c.-60_-45del16 NM_001406824.1:c.550_565del16 NP_001393753.1:p.Gly184Lysfs frameshift NM_001406825.1:c.550_565del16 NP_001393754.1:p.Gly184Lysfs frameshift NM_001406826.1:c.679_694del16 NP_001393755.1:p.Gly227Lysfs frameshift NM_001406827.1:c.550_565del16 NP_001393756.1:p.Gly184Lysfs frameshift NM_001406828.1:c.550_565del16 NP_001393757.1:p.Gly184Lysfs frameshift NM_001406829.1:c.-60_-45del16 NM_001406830.1:c.550_565del16 NP_001393759.1:p.Gly184Lysfs frameshift NR_176257.1:n.936_951del16 NR_176258.1:n.936_951del16 NR_176259.1:n.936_951del16 NR_176261.1:n.936_951del16 NC_000002.12:g.47798830_47798845del NC_000002.11:g.48025969_48025984del NG_007111.1:g.20684_20699del LRG_219:g.20684_20699del LRG_219t1:c.847_862del16 LRG_219p1:p.Gly283Lysfs - Protein change
- G283fs, G153fs
- Other names
- -
- Canonical SPDI
- NC_000002.12:47798824:GAGTGGGGGATAGTGAGAGTG:GAGTG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9158 | 9474 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (1) |
criteria provided, single submitter
|
Dec 29, 2021 | RCV002447605.2 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Mar 1, 2023 | RCV003316868.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Dec 29, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002677599.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.847_862del16 pathogenic mutation, located in coding exon 4 of the MSH6 gene, results from a deletion of 16 nucleotides at nucleotide positions 847 to … (more)
The c.847_862del16 pathogenic mutation, located in coding exon 4 of the MSH6 gene, results from a deletion of 16 nucleotides at nucleotide positions 847 to 862, causing a translational frameshift with a predicted alternate stop codon (p.G283Kfs*3). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. (less)
|
|
|
Pathogenic
(Mar 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Lynch syndrome 5
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV004019441.1
First in ClinVar: Jul 29, 2023 Last updated: Jul 29, 2023 |
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
|
Comment:
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
The c.847_862del16 pathogenic mutation, located in coding exon 4 of the MSH6 gene, results from a deletion of 16 nucleotides at nucleotide positions 847 to 862, causing a translational frameshift with a predicted alternate stop codon (p.G283Kfs*3). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Oct 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.