ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.3302_3353dup (p.Glu1118_Glu1119insAspPhePheTrpArgTer)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.3302_3353dup (p.Glu1118_Glu1119insAspPhePheTrpArgTer)
Variation ID: 1729995 Accession: VCV001729995.2
- Type and length
-
Duplication, 52 bp
- Location
-
Cytogenetic: 2p16.3 2: 47803546-47803547 (GRCh38) [ NCBI UCSC ] 2: 48030685-48030686 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Nov 29, 2022 May 1, 2024 Mar 1, 2022 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000179.3:c.3302_3353dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Glu1118_Glu1119insAspPhePheTrpArgTer nonsense inframe insertion NM_000179.2:c.3302_3353dupAGACTTTTTTTGGAGATGATTTTATTCCTAATGACATTCTAATAGGCTGTGA frameshift NM_001281492.2:c.2912_2963dup NP_001268421.1:p.Glu988_Glu989insAspPhePheTrpArgTer nonsense inframe insertion NM_001281493.2:c.2396_2447dup NP_001268422.1:p.Glu816_Glu817insAspPhePheTrpArgTer nonsense inframe insertion NM_001281494.2:c.2396_2447dup NP_001268423.1:p.Glu816_Glu817insAspPhePheTrpArgTer nonsense inframe insertion NM_001406795.1:c.3398_3449dup NP_001393724.1:p.Glu1151Aspfs frameshift NM_001406796.1:c.3302_3353dup NP_001393725.1:p.Glu1119Aspfs frameshift NM_001406797.1:c.3005_3056dup NP_001393726.1:p.Glu1020Aspfs frameshift NM_001406799.1:c.2777_2828dup NP_001393728.1:p.Glu944Aspfs frameshift NM_001406800.1:c.3302_3353dup NP_001393729.1:p.Glu1119Aspfs frameshift NM_001406801.1:c.3005_3056dup NP_001393730.1:p.Glu1020Aspfs frameshift NM_001406802.1:c.3398_3449dup NP_001393731.1:p.Glu1151Aspfs frameshift NM_001406803.1:c.2438_2489dup NP_001393732.1:p.Glu831Aspfs frameshift NM_001406804.1:c.3224_3275dup NP_001393733.1:p.Glu1093Aspfs frameshift NM_001406805.1:c.3005_3056dup NP_001393734.1:p.Glu1020Aspfs frameshift NM_001406806.1:c.2777_2828dup NP_001393735.1:p.Glu944Aspfs frameshift NM_001406807.1:c.2777_2828dup NP_001393736.1:p.Glu944Aspfs frameshift NM_001406808.1:c.3302_3353dup NP_001393737.1:p.Glu1119Aspfs frameshift NM_001406809.1:c.3302_3353dup NP_001393738.1:p.Glu1119Aspfs frameshift NM_001406811.1:c.2396_2447dup NP_001393740.1:p.Glu817Aspfs frameshift NM_001406812.1:c.2396_2447dup NP_001393741.1:p.Glu817Aspfs frameshift NM_001406813.1:c.3308_3359dup NP_001393742.1:p.Glu1121Aspfs frameshift NM_001406814.1:c.2396_2447dup NP_001393743.1:p.Glu817Aspfs frameshift NM_001406815.1:c.2396_2447dup NP_001393744.1:p.Glu817Aspfs frameshift NM_001406816.1:c.2396_2447dup NP_001393745.1:p.Glu817Aspfs frameshift NM_001406817.1:c.1736_1787dup NP_001393746.1:p.Glu597Aspfs frameshift NM_001406818.1:c.3005_3056dup NP_001393747.1:p.Glu1020Aspfs frameshift NM_001406819.1:c.3005_3056dup NP_001393748.1:p.Glu1020Aspfs frameshift NM_001406820.1:c.3005_3056dup NP_001393749.1:p.Glu1020Aspfs frameshift NM_001406821.1:c.3005_3056dup NP_001393750.1:p.Glu1020Aspfs frameshift NM_001406822.1:c.3005_3056dup NP_001393751.1:p.Glu1020Aspfs frameshift NM_001406823.1:c.2396_2447dup NP_001393752.1:p.Glu817Aspfs frameshift NM_001406824.1:c.3005_3056dup NP_001393753.1:p.Glu1020Aspfs frameshift NM_001406825.1:c.3005_3056dup NP_001393754.1:p.Glu1020Aspfs frameshift NM_001406826.1:c.3134_3185dup NP_001393755.1:p.Glu1063Aspfs frameshift NM_001406827.1:c.3005_3056dup NP_001393756.1:p.Glu1020Aspfs frameshift NM_001406828.1:c.3005_3056dup NP_001393757.1:p.Glu1020Aspfs frameshift NM_001406829.1:c.2396_2447dup NP_001393758.1:p.Glu817Aspfs frameshift NM_001406830.1:c.3005_3056dup NP_001393759.1:p.Glu1020Aspfs frameshift NM_001406831.1:c.83_134dup NP_001393760.1:p.Glu46Aspfs frameshift NM_001406832.1:c.149_200dup NP_001393761.1:p.Glu68Aspfs frameshift NM_001407362.1:c.1247_1298dup NP_001394291.1:p.Glu434Aspfs frameshift NR_176256.1:n.2232_2283dup NR_176257.1:n.3563_3614dup NR_176258.1:n.3492_3543dup NR_176259.1:n.3391_3442dup NR_176260.1:n.1336_1387dup NR_176261.1:n.3391_3442dup NC_000002.12:g.47803549_47803600dup NC_000002.11:g.48030688_48030739dup NG_007111.1:g.25403_25454dup LRG_219:g.25403_25454dup LRG_219t1:c.3302_3353dup LRG_219p1:p.Glu1119Aspfs - Protein change
- Other names
- -
- Canonical SPDI
- -
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9149 | 9462 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Mar 1, 2022 | RCV002454706.2 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Mar 01, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002612116.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
The c.3302_3353dup52 variant, located in coding exon 5 of the MSH6 gene, results from a duplication of 52 amino acids at nucleotide position 3302, causing … (more)
The c.3302_3353dup52 variant, located in coding exon 5 of the MSH6 gene, results from a duplication of 52 amino acids at nucleotide position 3302, causing a translational frameshift with a predicted alternate stop codon (p.E1119Dfs*6). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated May 01, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.