ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.4074_*37dup (p.Lys1358_Ter1361=)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.4074_*37dup (p.Lys1358_Ter1361=)
Variation ID: 1684901 Accession: VCV001684901.1
- Type and length
-
Duplication, 47 bp
- Location
-
Cytogenetic: 2p16.3 2: 47806849-47806850 (GRCh38) [ NCBI UCSC ] 2: 48033988-48033989 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline May 28, 2022 May 28, 2022 May 4, 2022 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_000179.3:c.4074_*37dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Lys1358_Ter1361= no sequence alteration NM_001281492.2:c.3684_*37dup NP_001268421.1:p.Lys1228_Ter1231= no sequence alteration NM_001281493.2:c.3168_*37dup NP_001268422.1:p.Lys1056_Ter1059= no sequence alteration NM_001281494.2:c.3168_*37dup NP_001268423.1:p.Lys1056_Ter1059= no sequence alteration NM_001406795.1:c.4170_*37dup NP_001393724.1:p.Lys1390_Ter1393= no sequence alteration NM_001406796.1:c.4074_*37dup NP_001393725.1:p.Lys1358_Ter1361= no sequence alteration NM_001406797.1:c.3777_*37dup NP_001393726.1:p.Lys1259_Ter1262= no sequence alteration NM_001406798.1:c.3900_*37dup NP_001393727.1:p.Lys1300_Ter1303= no sequence alteration NM_001406799.1:c.3549_*37dup NP_001393728.1:p.Lys1183_Ter1186= no sequence alteration NM_001406800.1:c.*95_*141dup 3 prime UTR NM_001406801.1:c.*55_*101dup 3 prime UTR NM_001406802.1:c.*55_*101dup 3 prime UTR NM_001406803.1:c.3210_*37dup NP_001393732.1:p.Lys1070_Ter1073= no sequence alteration NM_001406804.1:c.3996_*37dup NP_001393733.1:p.Lys1332_Ter1335= no sequence alteration NM_001406805.1:c.3777_*37dup NP_001393734.1:p.Lys1259_Ter1262= no sequence alteration NM_001406806.1:c.3549_*37dup NP_001393735.1:p.Lys1183_Ter1186= no sequence alteration NM_001406807.1:c.3549_*37dup NP_001393736.1:p.Lys1183_Ter1186= no sequence alteration NM_001406808.1:c.*55_*101dup 3 prime UTR NM_001406809.1:c.4074_*37dup NP_001393738.1:p.Lys1358_Ter1361= no sequence alteration NM_001406811.1:c.3168_*37dup NP_001393740.1:p.Lys1056_Ter1059= no sequence alteration NM_001406812.1:c.3168_*37dup NP_001393741.1:p.Lys1056_Ter1059= no sequence alteration NM_001406813.1:c.4080_*37dup NP_001393742.1:p.Lys1360_Ter1363= no sequence alteration NM_001406814.1:c.3168_*37dup NP_001393743.1:p.Lys1056_Ter1059= no sequence alteration NM_001406815.1:c.3168_*37dup NP_001393744.1:p.Lys1056_Ter1059= no sequence alteration NM_001406816.1:c.3168_*37dup NP_001393745.1:p.Lys1056_Ter1059= no sequence alteration NM_001406817.1:c.2508_*37dup NP_001393746.1:p.Lys836_Ter839= no sequence alteration NM_001406818.1:c.3777_*37dup NP_001393747.1:p.Lys1259_Ter1262= no sequence alteration NM_001406819.1:c.3777_*37dup NP_001393748.1:p.Lys1259_Ter1262= no sequence alteration NM_001406820.1:c.3777_*37dup NP_001393749.1:p.Lys1259_Ter1262= no sequence alteration NM_001406821.1:c.3777_*37dup NP_001393750.1:p.Lys1259_Ter1262= no sequence alteration NM_001406822.1:c.*55_*101dup 3 prime UTR NM_001406823.1:c.3168_*37dup NP_001393752.1:p.Lys1056_Ter1059= no sequence alteration NM_001406824.1:c.3777_*37dup NP_001393753.1:p.Lys1259_Ter1262= no sequence alteration NM_001406825.1:c.3777_*37dup NP_001393754.1:p.Lys1259_Ter1262= no sequence alteration NM_001406826.1:c.3906_*37dup NP_001393755.1:p.Lys1302_Ter1305= no sequence alteration NM_001406827.1:c.3777_*37dup NP_001393756.1:p.Lys1259_Ter1262= no sequence alteration NM_001406828.1:c.3777_*37dup NP_001393757.1:p.Lys1259_Ter1262= no sequence alteration NM_001406829.1:c.3168_*37dup NP_001393758.1:p.Lys1056_Ter1059= no sequence alteration NM_001406830.1:c.3777_*37dup NP_001393759.1:p.Lys1259_Ter1262= no sequence alteration NM_001406831.1:c.855_*37dup NP_001393760.1:p.Lys285_Ter288= no sequence alteration NM_001406832.1:c.921_*37dup NP_001393761.1:p.Lys307_Ter310= no sequence alteration NM_001407362.1:c.2019_*37dup NP_001394291.1:p.Lys673_Ter676= no sequence alteration NR_176256.1:n.3004_3050dup non-coding transcript variant NR_176257.1:n.4335_4381dup non-coding transcript variant NR_176258.1:n.4264_4310dup non-coding transcript variant NR_176259.1:n.4163_4209dup non-coding transcript variant NR_176260.1:n.2108_2154dup NR_176261.1:n.4045_4091dup non-coding transcript variant NC_000002.12:g.47806851_47806897dup NC_000002.11:g.48033990_48034036dup NG_007111.1:g.28705_28751dup NG_008397.1:g.103780_103826dup LRG_219:g.28705_28751dup LRG_219t1:c.4074_*37dup LRG_219p1:p.Lys1358_Ter(1361_?)(?) - Protein change
- -
- Other names
- -
- Canonical SPDI
- NC_000002.12:47806849:AGGAATTATAGACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACA:AGGAATTATAGACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACAGGAATTATAGACTGACTACATTGGAAGCTTTGAGTTGACTTCTGACA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9161 | 9479 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Uncertain significance (1) |
criteria provided, single submitter
|
May 4, 2022 | RCV002247993.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Uncertain significance
(May 04, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Mendelics
Accession: SCV002518283.1
First in ClinVar: May 28, 2022 Last updated: May 28, 2022 |
|
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
Help| There are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for rs2104585775 ...
HelpRecord last updated Dec 25, 2023
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.