VCV000142455.23 - ClinVar

NM_004360.5(CDH1):c.32TGC[7] (p.Leu14_Leu15dup)

Germline

Top reviewed classifications are shown here.

Submission summary:

6 submissions

6 submitters

4 conditions

Reviewed by expert panel

Likely benign

Aug 2023 by ClinGen CDH1 V… FDA Recognized Database

for CDH1-related diffuse gastric and lobular breast cancer syndrome

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_004360.5(CDH1):c.32TGC[7] (p.Leu14_Leu15dup)

Variation ID: 142455 Accession: VCV000142455.23

Type and length

Microsatellite, 6 bp

Location

Cytogenetic: 16q22.1 16: 68737444-68737445 (GRCh38) [ NCBI UCSC ] 16: 68771347-68771348 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 29, 2017	May 1, 2024	Aug 18, 2023

HGVS

Nucleotide	Protein	Molecular consequence
NM_004360.5(CDH1):c.32_34TGC[7] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.		inframe insertion
NM_004360.5:c.32TGC[7] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_004351.1:p.Leu14_Leu15dup	inframe insertion
NM_004360.5:c.41_46dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_001317184.2:c.32TGC[7]	NP_001304113.1:p.Leu14_Leu15dup	inframe insertion
NM_001317185.2:c.-1584TGC[7]		5 prime UTR
NM_001317186.2:c.-1788TGC[7]		5 prime UTR
NM_004360.3:c.41_46dup
NM_004360.4:c.32_46TGC[7]
NM_004360.4:c.41_46dup
NC_000016.10:g.68737447TGC[7]
NC_000016.9:g.68771350TGC[7]
NG_008021.1:g.5156TGC[7]
LRG_301:g.5156TGC[7]
LRG_301t1:c.41_46dup

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000016.10:68737444:GCTGCTGCTGCTGCTGC:GCTGCTGCTGCTGCTGCTGCTGC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA168401 dbSNP: rs587782476 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
CDH1		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	4456	4550

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Hereditary cancer-predisposing syndrome	Conflicting interpretations of pathogenicity (2)	criteria provided, conflicting classifications	Jun 28, 2023	RCV000131585.13
not provided	Likely benign (1)	criteria provided, single submitter	Nov 13, 2020	RCV000480757.3
Hereditary diffuse gastric adenocarcinoma	Conflicting interpretations of pathogenicity (2)	criteria provided, conflicting classifications	Jan 18, 2024	RCV000473416.15
CDH1-related diffuse gastric and lobular breast cancer syndrome	Likely benign (1)	reviewed by expert panel	Aug 18, 2023	RCV003328224.2

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely benign (Aug 18, 2023)	reviewed by expert panel (ClinGen CDH1 ACMG Specifications V3.1) Method: curation	CDH1-related diffuse gastric and lobular breast cancer syndrome (Autosomal dominant inheritance) Affected status: unknown Allele origin: germline	ClinGen CDH1 Variant Curation Expert Panel FDA Recognized Database Accession: SCV001365451.2 First in ClinVar: Jul 04, 2020 Last updated: Sep 20, 2023	Other databases https://erepo.clinicalgenome.org… https://erepo.clinicalgenome.org/evrepo/ui/interpretation/32a09493-4519-46f6-b57a-e60d03a9272e Comment: The c.32_34TGC[7] (p.Leu14_Leu15dup) variant results in an in-frame insertion in exon 1. This variant has a frequency of 0.0008% in gnomAD (1 of 124,448) (PM2_Supporting; … (more) The c.32_34TGC[7] (p.Leu14_Leu15dup) variant results in an in-frame insertion in exon 1. This variant has a frequency of 0.0008% in gnomAD (1 of 124,448) (PM2_Supporting; https://gnomad.broadinstitute.org/). However, this region has poor coverage and allele frequency estimates may not be reliable. This variant has also been identified in at least ten individuals without DGC, SRC tumours and LBC and whose families do not suggest HDGC (BS2, SCV000569203.4, SCV000186596.5, SCV000545430.4). In summary, this variant meets criteria to be classified as likely benign based on ACMG/AMP criteria applied as specified by the CDH1 Variant Curation Expert Panel (Variant Interpretation Guidelines Version 3.1): BS2, PM2_Supporting. (less)
Likely benign (Aug 01, 2022)	criteria provided, single submitter (Lee et al. (Hum Mutat. 2018)) Method: clinical testing	Hereditary diffuse gastric adenocarcinoma (Autosomal dominant inheritance) Affected status: no Allele origin: germline	European Reference Network on Genetic Tumour Risk Syndromes (ERN-GENTURIS), i3s - Instituto de Investigação e Inovação em Saúde, University of Porto Study: ERN GENTURIS Accession: SCV003926715.1 First in ClinVar: Jun 03, 2023 Last updated: Jun 03, 2023	Publications: PubMed (1) PubMed: 36436516 Comment: BS2, PM2 (PMID: 30311375) Geographic origin: Europe Comment on evidence: 2 families not fulfilling 2020 HDGC criteria-2 Familial history of breast cancer
Uncertain significance (Jan 18, 2024)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	Hereditary diffuse gastric adenocarcinoma Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV000545430.8 First in ClinVar: Apr 17, 2017 Last updated: Feb 20, 2024	Publications: PubMed (2) PubMed: 28492532‚ 36436516 Comment: This variant, c.41_46dup, results in the insertion of 2 amino acid(s) of the CDH1 protein (p.Leu14_Leu15dup), but otherwise preserves the integrity of the reading frame. … (more) This variant, c.41_46dup, results in the insertion of 2 amino acid(s) of the CDH1 protein (p.Leu14_Leu15dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs587782476, gnomAD 0.005%). This variant has been observed in individual(s) with breast cancer (PMID: 36436516). ClinVar contains an entry for this variant (Variation ID: 142455). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. (less)
Likely benign (Jun 28, 2023)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Hereditary cancer-predisposing syndrome Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV000186596.9 First in ClinVar: Aug 06, 2014 Last updated: May 01, 2024	Publications: PubMed (1) PubMed: 36436516 Comment: This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of … (more) This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. (less)
Likely benign (Nov 13, 2020)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV000569203.4 First in ClinVar: Apr 29, 2017 Last updated: Apr 29, 2017	Comment: Not observed in large population cohorts (Lek et al., 2016); In-frame insertion of 2 amino acids in a repetitive region with no known function; Has … (more) Not observed in large population cohorts (Lek et al., 2016); In-frame insertion of 2 amino acids in a repetitive region with no known function; Has not been previously published as pathogenic or benign to our knowledge (less)
Uncertain significance (Jan 09, 2023)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Hereditary cancer-predisposing syndrome Affected status: unknown Allele origin: germline	Color Diagnostics, LLC DBA Color Health Accession: SCV000689536.4 First in ClinVar: Feb 19, 2018 Last updated: Feb 14, 2024	Comment: This variant is a two amino acid duplication located in exon 1 of the CDH1 protein. To our knowledge, functional studies have not been reported … (more) This variant is a two amino acid duplication located in exon 1 of the CDH1 protein. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with CDH1-related disorders in the literature. This variant has been identified in 1/124448 chromosomes in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. (less)

Comment:

The c.32_34TGC[7] (p.Leu14_Leu15dup) variant results in an in-frame insertion in exon 1. This variant has a frequency of 0.0008% in gnomAD (1 of 124,448) (PM2_Supporting; https://gnomad.broadinstitute.org/). However, this region has poor coverage and allele frequency estimates may not be reliable. This variant has also been identified in at least ten individuals without DGC, SRC tumours and LBC and whose families do not suggest HDGC (BS2, SCV000569203.4, SCV000186596.5, SCV000545430.4). In summary, this variant meets criteria to be classified as likely benign based on ACMG/AMP criteria applied as specified by the CDH1 Variant Curation Expert Panel (Variant Interpretation Guidelines Version 3.1): BS2, PM2_Supporting.

Comment:

This variant, c.41_46dup, results in the insertion of 2 amino acid(s) of the CDH1 protein (p.Leu14_Leu15dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs587782476, gnomAD 0.005%). This variant has been observed in individual(s) with breast cancer (PMID: 36436516). ClinVar contains an entry for this variant (Variation ID: 142455). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

Comment:

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity.

Comment:

This variant is a two amino acid duplication located in exon 1 of the CDH1 protein. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with CDH1-related disorders in the literature. This variant has been identified in 1/124448 chromosomes in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Genotype-first approach to identify associations between CDH1 germline variants and cancer phenotypes: a multicentre study by the European Reference Network on Genetic Tumour Risk Syndromes.	Garcia-Pelaez J	The Lancet. Oncology	2023	PMID: 36436516
https://erepo.clinicalgenome.org/evrepo/ui/interpretation/32a09493-4519-46f6-b57a-e60d03a9272e	-	-	-	-

Text-mined citations for rs587782476 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 29, 2024

ClinVar Genomic variation as it relates to human health

NM_004360.5(CDH1):c.32TGC[7] (p.Leu14_Leu15dup)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs587782476 ...